Home  ›  Gatk the Input .bam File Contains Reads With No Platform Information

Gatk the Input .bam File Contains Reads With No Platform Information

Written By Thursday, 3 March 2022 Add Comment Edit

IMPORTANT: This is the legacy GATK Forum Website. This information is but valid until Dec 31st 2019. For latest documentation and forum click here

created by shlee
on 2015-11-23

Here we outline how to generate an unmapped BAM (uBAM) from either a FASTQ or aligned BAM file. We use Picard's FastqToSam to convert a FASTQ (Pick A) or Picard'south RevertSam to convert an aligned BAM (Pick B).

Leap to a section on this page

(A) Convert FASTQ to uBAM and add read grouping information using FastqToSam (B) Convert aligned BAM to uBAM and discard problematic records using RevertSam

Tools involved

  • FastqToSam
  • RevertSam

Prerequisites

  • Installed Picard tools

Download example data

  • tutorial6484FastqToSam.tar.gz
  • tutorial6484RevertSam.tar.gz

Tutorial data reads were originally aligned to the advanced tutorial parcel'south humang1kv37_decoy.fasta reference and to 10:91,000,000-92,000,000.

Related resource

  • Our dictionary entry on read groups discusses the importance of assigning advisable read group fields that differentiate samples and factors that contribute to batch furnishings, e.g. menstruum cell lane. Be sure your read group fields suit to the recommendations.
  • This post provides an example command for AddOrReplaceReadGroups.
  • ThisHow to is office of a larger workflow and tutorial on (How to) Efficiently map and make clean up short read sequence data.
  • To extract reads in a genomic interval from the aligned BAM, use GATK's PrintReads.

(A) Catechumen FASTQ to uBAM and add together read group information using FastqToSam

Picard'south FastqToSam transforms a FASTQ file to an unmapped BAM, requires ii read group fields and makes optional specification of other read group fields. In the command below nosotros note which fields are required for GATK All-time Practices Workflows. All other read group fields are optional.

java -Xmx8G -jar picard.jar FastqToSam \     FASTQ=6484_snippet_1.fastq \ #first read file of pair     FASTQ2=6484_snippet_2.fastq \ #2nd read file of pair     OUTPUT=6484_snippet_fastqtosam.bam \     READ_GROUP_NAME=H0164.2 \ #required; inverse from default of A     SAMPLE_NAME=NA12878 \ #required     LIBRARY_NAME=Solexa-272222 \ #required      PLATFORM_UNIT=H0164ALXX140820.2 \      PLATFORM=illumina \ #recommended     SEQUENCING_CENTER=BI \      RUN_DATE=2014-08-20T00:00:00-0400

Some details on select parameters:

  • For paired reads, specify each FASTQ file withFASTQ andFASTQ2 for the first read file and the second read file, respectively. Records in each file must be queryname sorted as the tool assumes identical ordering for pairs. The tool automatically strips the/i and/two read name suffixes and adds SAM flag values to indicate reads are paired. Do not provide a single interleaved fastq file, as the tool will presume reads are unpaired and the SAM flag values will reflect single concluded reads.
  • For single ended reads, specify the input file withFASTQ.
  • QUALITY_FORMAT is detected automatically if unspecified.
  • SORT_ORDER past default is queryname.
  • PLATFORM_UNIT is often in run_barcode.lane format. Include if sample is multiplexed.
  • RUN_DATE is in Iso8601 date format.

Paired reads will take SAM flag values that reflect pairing and the fact that the reads are unmapped as shown in the case read pair below.

Original outset read 

@H0164ALXX140820:2:1101:10003:49022/1 ACTTTAGAAATTTACTTTTAAGGACTTTTGGTTATGCTGCAGATAAGAAATATTCTTTTTTTCTCCTATGTCAGTATCCCCCATTGAAATGACAATAACCTAATTATAAATAAGAATTAGGCTTTTTTTTGAACAGTTACTAGCCTATAGA + -FFFFFJJJJFFAFFJFJJFJJJFJFJFJJJ<<FJJJJFJFJFJJJJ<JAJFJJFJJJJJFJJJAJJJJJJFFJFJFJJFJJFFJJJFJJJFJJFJJFJAJJJJAJFJJJJJFFJJ<<<JFJJAFJAAJJJFFFFFJJJAJJJF<AJFFFJ

Original second read 

@H0164ALXX140820:2:1101:10003:49022/2 TGAGGATCACTAGATGGGGGAGGGAGAGAAGAGATGTGGGCTGAAGAACCATCTGTTGGGTAATATGTTTACTGTCAGTGTGATGGAATAGCTGGGACCCCAAGCGTCAGTGTTACACAACTTACATCTGTTGATCGACTGTCTATGACAG + AA<FFJJJAJFJFAFJJJJFAJJJJJ7FFJJ<F-FJFJJJFJJFJJFJJF<FJJA<JF-AFJFAJFJJJJJAAAFJJJJJFJJF-FF<7FJJJJJJ-JA<<J<F7-<FJFJJ7AJAF-AFFFJA--J-F######################

Later FastqToSam 

H0164ALXX140820:2:1101:10003:49022      77      *       0       0       *       *       0       0       ACTTTAGAAATTTACTTTTAAGGACTTTTGGTTATGCTGCAGATAAGAAATATTCTTTTTTTCTCCTATGTCAGTATCCCCCATTGAAATGACAATAACCTAATTATAAATAAGAATTAGGCTTTTTTTTGAACAGTTACTAGCCTATAGA -FFFFFJJJJFFAFFJFJJFJJJFJFJFJJJ<<FJJJJFJFJFJJJJ<JAJFJJFJJJJJFJJJAJJJJJJFFJFJFJJFJJFFJJJFJJJFJJFJJFJAJJJJAJFJJJJJFFJJ<<<JFJJAFJAAJJJFFFFFJJJAJJJF<AJFFFJ RG:Z:H0164.2 H0164ALXX140820:two:1101:10003:49022      141     *       0       0       *       *       0       0       TGAGGATCACTAGATGGGGGAGGGAGAGAAGAGATGTGGGCTGAAGAACCATCTGTTGGGTAATATGTTTACTGTCAGTGTGATGGAATAGCTGGGACCCCAAGCGTCAGTGTTACACAACTTACATCTGTTGATCGACTGTCTATGACAG AA<FFJJJAJFJFAFJJJJFAJJJJJ7FFJJ<F-FJFJJJFJJFJJFJJF<FJJA<JF-AFJFAJFJJJJJAAAFJJJJJFJJF-FF<7FJJJJJJ-JA<<J<F7-<FJFJJ7AJAF-AFFFJA--J-F###################### RG:Z:H0164.two

back to top

(B) Convert aligned BAM to uBAM and discard problematic records using RevertSam

We use Picard's RevertSam to remove alignment information and generate an unmapped BAM (uBAM). For our tutorial file we accept to call on some additional parameters that we explicate below. This illustrates the need to cater the tool'due south parameters to each dataset. Every bit such, it is a good idea to test the reversion process on a subset of reads before committing to reverting the entirety of a large BAM. Follow the directions in thisHow to to create a snippet of aligned reads corresponding to a genomic interval.

Nosotros utilise the following parameters.

coffee -Xmx8G -jar /path/picard.jar RevertSam \     I=6484_snippet.bam \     O=6484_snippet_revertsam.bam \     SANITIZE=true \      MAX_DISCARD_FRACTION=0.005 \ #advisory; does not affect processing     ATTRIBUTE_TO_CLEAR=XT \     ATTRIBUTE_TO_CLEAR=XN \     ATTRIBUTE_TO_CLEAR=Equally \ #Picard release of 9/2015 clears Every bit by default     ATTRIBUTE_TO_CLEAR=OC \     ATTRIBUTE_TO_CLEAR=OP \     SORT_ORDER=queryname \ #default     RESTORE_ORIGINAL_QUALITIES=true \ #default     REMOVE_DUPLICATE_INFORMATION=true \ #default     REMOVE_ALIGNMENT_INFORMATION=true #default

To process large files, also designate a temporary directory.

          TMP_DIR=/path/shlee #sets ecology variable for temporary directory

We invoke or change multiple RevertSam parameters to generate an unmapped BAM

  • We remove nonstandard alignment tags with theATTRIBUTE_TO_CLEAR option. Standard tags cleared by default are NM, UQ, PG, Doc, MQ, SA, MC, and Equally tags (Equally for Picard releases starting 9/2015). Additionally, the OQ tag is removed by the defaultRESTORE_ORIGINAL_QUALITIES parameter. Remove all other nonstandard tags by specifying each with theATTRIBUTE_TO_CLEAR option. For example, we clear theXT tag using this option for our tutorial file then that it is gratis for use by other tools, e.m. MarkIlluminaAdapters. To listing all tags inside a BAM, use the command below.

    samtools view input.bam | cut -f 12- | tr '\t' '\n' | cutting -d ':' -f 1 | awk '{ if(!x[$1]++) { print }}'

    For the tutorial file, this gives RG, OC, XN, OP and XT tags as well as those removed by default. We remove all of these except the RG tag. See your aligner's documentation and the Sequence Alignment/Map Format Specification for descriptions of tags.

  • Additionally, we invoke theSANITIZE option to remove reads that cause bug for certain tools, e.g. MarkIlluminaAdapters. Downstream tools will have problems with paired reads with missing mates, duplicated records, and records with mismatches in length of bases and qualities. Any paired reads file subset for a genomic interval requires sanitizing to remove reads with lost mates that marshal outside of the interval.

  • In this command, we've setMAX_DISCARD_FRACTION to a more strict threshold of 0.005 instead of the default 0.01. Whether or not this fraction is reached, the tool informs you of the number and fraction of reads information technology discards. This parameter asks the tool to additionally inform you lot of the discarded fraction via an exception as it finishes processing.

    Exception in thread "main" picard.PicardException: Discarded 0.787% which is above MAX_DISCARD_FRACTION of 0.500%

Some comments on options kept at default:

  • SORT_ORDER=queryname For paired read files, because each read in a pair has the aforementioned query name, sorting results in interleaved reads. This ways that reads in a pair are listed consecutively within the aforementioned file. We make sure to modify the previous sort social club. Coordinate sorted reads result in the aligner incorrectly estimating insert size from blocks of paired reads as they are non randomly distributed.
  • RESTORE_ORIGINAL_QUALITIES=truthful Restoring original base qualities to the QUAL field requires OQ tags listing original qualities. The OQ tag uses the aforementioned encoding as the QUAL field, e.g. ASCII Phred-scaled base of operations quality+33 for tutorial information. After restoring the QUAL field, RevertSam removes the tag.
  • REMOVE_ALIGNMENT_INFORMATION=truthful will remove plan group records and alignment flag and tag information. For example, flags reset to unmapped values, east.thousand. 77 and 141 for paired reads. The parameter also invokes the defaultATTRIBUTE_TO_CLEAR parameter which removes standard alignment tags. RevertSam ignoresATTRIBUTE_TO_CLEAR whenREMOVE_ALIGNMENT_INFORMATION=fake.

Below we show below a read pair before and after RevertSam from the tutorial data. Observe the first listed read in the pair becomesopposite-complemented afterward RevertSam. This restores how reads are represented when they come up off the sequencer--5' to iii' of the read being sequenced.

For 6484_snippet.bam,SANITIZE removes 2,202 out of 279,796 (0.787%) reads, leaving the states with 277,594 reads.

Original BAM 

H0164ALXX140820:2:1101:10003:23460  83  ten  91515318    sixty  151M    =   91515130    -339    CCCATCCCCTTCCCCTTCCCTTTCCCTTTCCCTTTTCTTTCCTCTTTTAAAGAGACAAGGTCTTGTTCTGTCACCCAGGCTGGAATGCAGTGGTGCAGTCATGGCTCACTGCCGCCTCAGACTTCAGGGCAAAAGCAATCTTTCCAGCTCA :<<=>@AAB@AA@AA>6@@A:>,*@A@<@??@eight?9>@==8?:?@?;?:><??@>==nine?>8>@:?>>=>;<==>>;>?=?>>=<==>>=>9<=>??>?>;8>?><?<=:>>>;4>=>7=6>=>>=><;=;>===?=>=>>?ix>>>>??==== MC:Z:60M91S Medico:Z:151    PG:Z:MarkDuplicates RG:Z:H0164.two    NM:i:0  MQ:i:0  OQ:Z:<FJFFJJJJFJJJJJF7JJJ<F--JJJFJJJJ<J<FJFF<JAJJJAJAJFFJJJFJAFJAJJAJJJJJFJJJJJFJJFJJJJFJFJJJJFFJJJJJJJFAJJJFJFJFJJJFFJJJ<J7JJJJFJ<AFAJJJJJFJJJJJAJFJJAFFFFA    UQ:i:0  AS:i:151  H0164ALXX140820:2:1101:10003:23460  163 10  91515130    0   60M91S  =   91515318    339 TCTTTCCTTCCTTCCTTCCTTGCTCCCTCCCTCCCTCCTTTCCTTCCCCCCCCCCCCCCCCCTCCCCCCCCCCCCCCCCCTCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTTCCCCTCTCCCACCCCTCTCTCCCCCCCTCCCACCC :0;.=;8?7==?794<<;:>769=,<;0:=<0=:ix===/,:-==29>;,5,98=599;<=########################################################################################### SA:Z:2,33141573,-,37S69M45S,0,1;    MC:Z:151M   Physician:Z:48T4T6 PG:Z:MarkDuplicates RG:Z:H0164.2    NM:i:two  MQ:i:60 OQ:Z:<-<-FA<F<FJF<A7AFAAJ<<AA-FF-AJF-FA<AFF--A-FA7AJA-7-A<F7<<AFF###########################################################################################    UQ:i:49 AS:i:fifty

After RevertSam ```` H0164ALXX140820:2:1101:10003:23460 77 * 0 0 * * 0 0 TGAGCTGGAAAGATTGCTTTTGCCCTGAAGTCTGAGGCGGCAGTGAGCCATGACTGCACCACTGCATTCCAGCCTGGGTGACAGAACAAGACCTTGTCTCTTTAAAAGAGGAAAGAAAAGGGAAAGGGAAAGGGAAGGGGAAGGGGATGGG AFFFFAJJFJAJJJJJFJJJJJAFA

H0164ALXX140820:2:1101:10003:23460 141 * 0 0 * * 0 0 TCTTTCCTTCCTTCCTTCCTTGCTCCCTCCCTCCCTCCTTTCCTTCCCCCCCCCCCCCCCCCTCCCCCCCCCCCCCCCCCTCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTTCCCCTCTCCCACCCCTCTCTCCCCCCCTCCCACCC <-<-FAback to top

Updated on 2017-06-23

From aneek on 2016-04-eighteen

Hi,

How to perform FastqToSam function in picardtools when the fastq files are not interleaved i.e. forrad (R1) and opposite (R2) fastq files separately. Picardtools is non taking two FASTQ inputs.

Error message: "Option 'FASTQ' cannot be specified more than than once."


From Sheila on 2016-04-18

@aneek
Hi,

If you wait at the [FastqToSam documentation](http://broadinstitute.github.io/picard/command-line-overview.html#FastqToSam), you will find your answer.

-Sheila


From aneek on 2016-04-19

@Sheila

Thank you very much. I have to use FASTQ2 for the second read.

Another thing I would like to enquire is, whether there is whatsoever need to use FastQC and Trimmomatic to correct the quality of the raw data and remove the bad reads, if I use these steps of making a make clean BAM from curt read sequence recommended by GATK.

Besides tin can I use threading selection (-t) in all GATK commands to increase the speed of the tasks.

Thank you lot.


From Sheila on 2016-04-xix

@aneek
Hi,

No, information technology is best to stick to the [Best Practices](https://www.broadinstitute.org/gatk/guide/best-practices). In that location should exist no demand to correct for annihilation before doing the Best Practices pre-processing steps.

Yous can find which tools accept -nt in the tool documentation.

-Sheila


From aneek on 2016-04-nineteen

@Sheila

Hello, Thank you very much for all the informations.


From MUHAMMADSOHAILRAZA on 2016-07-11

@Sheila

Hi,
I cannot download the case data set "tutorial_6484_RevertSam.tar.gz"/"tutorial_6484_FastqToSam.tar.gz" from above links..
In cathay, Because we don't have complete access to google, may be due to that reason i cannot download the information from google drive.. could yous please make information technology bachelor somewhere else? Similar as you do for "bundle" as an "instance" directory..

Thanks


From shlee on 2016-07-eleven

Hi @MUHAMMADSOHAILRAZA,

I've uploaded the tutorial datasets to the ftp site. You tin find the data for this and other tutorials at: . Like with the bundle, retrieve to keep the password field blank.


From MUHAMMADSOHAILRAZA on 2016-07-12

Thank you! @shlee


From MUHAMMADSOHAILRAZA on 2016-07-12

@shlee

Hi,
I am curious Why RG tag is absent for the first read of higher up "After RevertSam" results section?
and could you please explain what does 77 and 141 values represent in column 2?

Thanks


From shlee on 2016-07-12

@MUHAMMADSOHAILRAZA,

You can check yourself why this may be with the command:

samtools view 6484_snippet_revertsam.bam | grep 'H0164ALXX140820:2:1101:10003:23460'

Then y'all'll run across that both reads should have an RG tag. I've updated the example—thank you for pointing this out.

For an explanation of SAM flags, I refer you lot to the following:

- Picard'due south [Explicate SAM flags](https://broadinstitute.github.io/picard/explain-flags.html) webpage where you can type in a flag value to see their pregnant
- Blogpost [Sam flags down a boat](https://world wide web.broadinstitute.org/gatk/web log?id=7019) for an introduction
- [Sequence Alignment/Map Format Specification](https://samtools.github.io/hts-specs/SAMv1.pdf) for official specs


From huangk on 2016-09-15

Hi, I tried to convert my paired-end fastqs to SAM using FastqToSam, but got the fault: "In paired style, read name 1 (HWI-D00377:30:H8EJDADXX:1:2209:8491:93586) does not friction match read name ii (HWI-D00377:30:H8EJDADXX:ane:2104:20024:30303)". Is there anyway to set up it? Thank you!


From shlee on 2016-09-26

This question has been answered [here](http://gatkforums.broadinstitute.org/gatk/word/8308/whats-the-version-of-bwa-being-implemented-in-gatk4-bwaspark-tool#latest).


From abor on 2016-eleven-28

Hi,
I am using the script reported in paragraph "(B) Convert aligned BAM to uBAM and discard problematic records using RevertSam"
As suggested, I set the SANITIZE option as truthful (indeed, the process has bug already at the revertsam—>revertmark step when setting information technology as false).
However, for some older bam files, I loose every bit much every bit half of the reads. Meaning that my interleaved fastq file as well as my remapped bam is much smaller in size and script number. Is there a style to circumvent such a big loss?

Cheers!


From shlee on 2016-11-28

Hi @abor,

When you lot say you lot lose upwards to half of the reads, do you mean alignment records or unique reads? I enquire because an aligned BAM can represent the aforementioned read in multiple alignment records and the reversion to uBAM has the effect of dent these downward to i unique read.

Can yous also describe further the trouble yous are running into? It would exist helpful to usa if y'all can postal service the tool error message.


From abor on 2016-11-28

Hi, thanks. the err file reports:
"INFO 2016-11-25 15:41:50 RevertSam Discarded 23263512 out of 61936806 (37.560%) reads in gild to sanitize output."

Consistently, the read count in my original bam file is 61,955,464, in my interleaved fastq is 38673294 and in my final recalibrated bam (later on realignment/bqsr) is 38690072


From shlee on 2016-11-xxx

Ok, @abor. And so I call up the question becomes why practice yous want to save the discarded reads? Consider what property of the discarded reads acquired them to be discarded given SANITIZE discards paired reads with missing mates, duplicated records, and records with mismatches in length of bases and qualities. So consider what touch these reads have on your analyses. E.one thousand. exercise the remaining reads provide sufficient coverage or practice you demand all the coverage you tin salvage? Do the discarded reads qualitatively differ, eastward.g. have lower base qualities, than the remaining reads?

I think if they are qualitatively equivalent, so only the paired reads with missing mates would exist worth salvaging. If this is the case, then we'd have to think virtually how to retain such reads to the exclusion of the other sanitized reads. So you would outset RevertSam without sanitizing. Then, I believe yous can filter records with mismatches in length of bases and qualities using GATK'due south [MalformedReadFilter](https://software.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_gatk_engine_filters_MalformedReadFilter.php)'southward optional parameter `—filter_mismatching_base_and_quals`. Because your BAM at this point is unaligned, and therefore not coordinate-sorted, you take to run [PrintReads](https://software.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_gatk_tools_walkers_readutils_PrintReads.php) in `—unsafe` way and discard the bai index that the tool outputs. Every bit for duplicated records, a UNIX `sort` and `uniq` should remove these.

For example, for your unaligned uBAM:

```
samtools view ubam.bam | sort | uniq > ubam_uniquify.sam
```
Will print the unique reads to a SAM format file. You'll accept to reattach your header earlier converted again to BAM format. And then:

```
java -jar GenomeAnalysisTK.jar -T PrintReads \ -I uniquify_ubam.bam \ -o ubam_filter_mismatching_base_and_quals.bam \ -R your_reference.fasta \ —filter_mismatching_base_and_quals \ —unsafe
```

Also, take a look at the [ValidateSamFile document](https://software.broadinstitute.org/gatk/guide/article?id=7571). I hope this is helpful.


From abor on 2017-01-17

Hi @shlee, sorry for the long delay.
I went through the steps you suggest: on my original BAM file I employ RevertSam without SANITIZE, then use sort/uniq and then PrintReads with —filter_mismatching_base_and_quals —unsafe. The number of reads remains exactly the same I had in the original BAM; in addition, running ValidateSamFile Mode=SUMMARY gives me the following fault: Mistake:MATE_NOT_FOUND, and the number of reads with this fault is exactly the aforementioned number of reads that are discarded when I utilize RevertSam with SANITIZE=true. Turns out that the discarded reads are reads with missing mates (that were, however, regularly mapped in my original BAM), and that I would like to continue, given that they are as much every bit fifteen-45%of full reads, for some samples. However, the MarkIlluminaAdapters tool doesn't process the uBam file unless they accept been discarded. Do you lot think there may be a solution for this step to work properly as well in the presence of reads with missing pairs?
Thanks


From abor on 2017-01-17

Plus, I wonder why this happens. When using Bam files in which the RealignerTargetCreator and BaseRecalibrator steps are performed through the whole genome, I tin can pass the Bam files once again through the pipeline (RevertSam, MarkIlluminaAdapters, SamToFasq, BWA, MarkDuplicates and GATK RealignerTargetCreator/BaseRecalibrator) several times without loosing whatsoever reads; instead, I notice that when using the -L option on the bait regions at the RealignerTargetCreator and BaseRecalibrator steps, reads are discarded if the BAMs are later on re-passed through RevertSam.
Of grade I don't need to re-run RevertSam several times, but I could demand to practice it in the future. So the question is whether the -L choice at RealignerTargetCreator and BaseRecalibrator steps introduces any tag in the read so that it is and then discarded as "missing mate" when passed again through RevertSam. Hope to have been clear enough.
Thank you again for your aid


From Geraldine_VdAuwera on 2017-01-17

Removing reads that cause validation errors is what SANITIZE=TRUE is for. If y'all don't want to remove them you need to disable that selection — but then another tools may pass up to run on that data. Our supported pipelines all discard unpaired reads as a quality assurance measure.

When you use -Fifty in the preprocessing steps, do you use it as well with IndelRealigner and PrintReads?


From abor on 2017-01-17

Edited post: no, -L was used in RealignerTargetCreator, BaseRecalibrator and PrintReads, simply not in IndelRealigner


From abor on 2017-01-17

The question is why reads that were previously successfully mapped (they are mapped in the BAM file I use as input for RevertSam) are detected equally unpaired reads and discarded


From shlee on 2017-01-17

Hullo @abor,

Since you mention that you are using older BAM files, I presume you don't accept access to the original FASTQ files and the missing mates are forever gone. Is this true?

Information technology's my understanding that aligners such as BWA align each read independently, even ends of mated reads. That GATK tools accept congenital in quality control features that are different from that of aligners is to a user'due south benefit. At the to the lowest degree, y'all become aware of the quality of the information you are working with and can come to a determination on how to proceed with the discrepant data.

In reply to your question,

> Do you lot think there may be a solution for this pace to work properly also in the presence of reads with missing pairs?

my answer is yes, there is a solution. My understanding is that you wish to (i) procedure information through MarkIlluminaAdapters besides as (ii) go along themate not found reads. Roughly, I think yous tin split your paired reads andmate non found reads and process them as PE and SE reads separately, respectively. For instance, because processing through MarkIlluminaAdapters merely makes sense for PE reads (come across [Tutorial#6483](http://gatkforums.broadinstitute.org/wdl/give-and-take/6483#step2) for why), you lot would process just the PE BAM through this step ~~and skip this stride for the SE BAM.~~ `Deplorable, information technology appears MarkIlluminaAdapters has a parameter to process SE reads (MIN_MATCH_BASES_SE).`

To merge the reads together for joint processing for downstream steps, well, hither'south where you'd have to exercise some exploration of tools. I think yous would use either [MergeSamFiles](https://broadinstitute.github.io/picard/command-line-overview.html#MergeSamFiles) or [MergeBamAlignment](https://broadinstitute.github.io/picard/command-line-overview.html#MergeBamAlignment). [Tutorial#6483](http://gatkforums.broadinstitute.org/wdl/word/6483/how-to-map-and-clean-upward-brusque-read-sequence-data-efficiently) gives details on MergeBamAlignment. It volition take equally input multiple `ALIGNED_BAM` files, so y'all can provide it both the aligned PE BAM and aligned SE BAM.

I hope this is helpful. Permit united states of america know what ends upwards working for you and if you have additional questions.


From dnousome on 2017-01-17

Hello all,

I current have some RNA-Seq Tophat aligned files (no original fastq), both the Aligned bam and unmapped reads files and wanted to generate a fastq to align with some other aligner (STAR or Salmon).

Do you think I should attempt to merge the Aligned and unmapped files and then perform the conversion?

I have a feeling that might not be correct because it would insert potential reads with no mate. Otherwise I'm a piffling stuck every bit to what to do with the unmapped file.

Thanks for any assistance!
Darryl


From Geraldine_VdAuwera on 2017-01-17

@abor When you use -L with PrintReads, y'all're telling GATK to throw abroad any reads outside of those intervals. Then any reads inside the intervals that had mates outside become mate-non-founds.


From shlee on 2017-01-nineteen

Howdy Darryl ( @dnousome ),

Whichever file contains the complete set of read pairs, you can use this detail file. STAR takes FASTQ files and I assume Salmon besides takes FASTQ files. If the file you showtime with is the aligned BAM, you can revert using RevertSam, convert to FASTQ and so align with your aligner of choice. If information technology is the uBAM, then you can proceed with converting to FASTQ and then marshal. If you wish to pipe conversion to FASTQ and the alignment step, which allows you to avoid storing a FASTQ file, then checkout the workflow detailed in [Tutorial#6483](http://gatkforums.broadinstitute.org/gatk/give-and-take/6483) for BWA alignment. I believe the concepts should however apply to your case. The tutorial and so explains how and why you would use MergeBamAlignment.

I hope this is helpful.


From dnousome on 2017-01-19

@shlee

Nigh definitely! Thanks for your help.


From shlee on 2017-01-20

@abor, I've modified my last answer to you above.


From shlee on 2017-01-twenty

Update to RevertSam

An issue described by this forum question has been fixed by a Picard repo code change documented here equally a pull request and here equally the related github consequence. The effect of this code change is that when encountering mate-missing reads in a PE data file, RevertSam will at present remove all mate data and thereby effectively plow mate-missing records into SE reads.


From inesentis on 2017-05-nineteen

Dear all,

I have downloaded BAM files deposited in EGA from a study conducted some years ago. I practice no take information of the "state" of the BAM file. My idea is to process them again and then do the somatic variant calling with Mutect2. I accept checked a flake the BAM files and they are mapped and sorted by coordinates. Simply to make sure, do I have to follow part B of this tutorial? If I straight convert the BAM files (without applying RevertSam) into fastq files do I take to unmapped the BAM file first and then convert them to fastq?

Thanks!


From shlee on 2017-05-nineteen

How-do-you-do @inesentis,

There are many factors for you to consider, including:

one. How were the samples in the Panel of Normals (PoN) you lot will use preprocessed?
two. Do your BAM files contain multiple read groups? Remember that RevertSam tin separate these out with the OUTPUT_BY_READGROUP choice and that BQSR is performed at the lane level (dissimilar lanes must take dissimilar RG IDs). Alternatively, you could potentially queryname-sort your reads to identify the blocks that correspond to different read groups, if your BAMs follow the convention that read names represent to the RG ID or RD PU fields.
three. How are the different readgroups organized? Is there a PU field that also distinguishes them?
3. Practice your BAM files contain QC-failed reads (NON_PF marked by the 0×200 SAM flag)? You may consider removing these to ensure a conservative analysis.
4. Do your BAM files contain SE reads or mate-missing reads from a particular read group or mixed in with PE reads?
v. Are your tumor and normal pair samples named to differentiate them in the @RG SM field? MuTect2 requires these be different.

A first step towards answering these questions is to run your BAMs through ValidateSamFile also as samtools flagstat.

If yous volition employ MuTect2, if possible please be sure to utilise the GATK4 MuTect2, instead of the GATK3 MuTect2. Our developers say that GATK4'due south MuTect2 (in beta) is now ready for testing. It has improvements to GATK3'south MuTect2. You can find the jar at . Remember that beta status means it is only for testing and not necessarily gear up for product purposes.


From inesentis on 2017-05-22

1. I was not thinking of using a PoN since the information that I am downloading are tumor/normal pairs. Is information technology necessary? How do I built PoN for a study based on normal/tumor pair of samples?
ii. The problem with this BAM files is that there are no different RG IDs. In other words, all the files (even form different patients and irrespective of tumor/normal) have the same RG ID. To me it seems that they have sequenced all in the same lane or mayhap at some point they aggregate or plummet all the readgroups in the aforementioned BAM file and they lost the unique IDs. Non certain how to proceed in this case.
3. No RG PU tag found.
4. The QC -failed reads must have been removed since I do not take them when computing
```
>samtools flagstat anybam.bam
```
5. I practice have some singletons. Is at that place a threshold from which one tin not worry or exist worried virtually?
6. Yes! They do have different sample names


From shlee on 2017-05-22

Hi @inesentis,

I highly recommend the utilize of a PoN for somatic variant calling. You can see how to make 1 insection 1 of the MuTect2 hands-on tutorial listed [here](https://software.broadinstitute.org/gatk/blog?id=9044). The tutorial's PoN, I made information technology myself using publicly available 1000 Genomes Project data. I used xl WES datasets to match my tumor-normal pair WES dataset. The [MuTect2 tool documentation](https://software.broadinstitute.org/gatk/documentation/tooldocs/electric current/org_broadinstitute_gatk_tools_walkers_cancer_m2_MuTect2.php) also tells you how to go about making a PoN.

If y'all follow along the easily-on tutorial, using the provided example data, you meet the value of using a PoN, albeit a minimal PoN made from forty samples, insections 5 and 6. I have [WDL scripts](https://software.broadinstitute.org/wdl/) for creating this PoN in the cloud that I can share with you. You lot'll have to make your ain Docker prototype however as the Docker I use is my personal private Docker container and is unshareable.

Even if in that location are no RGIDs, it may be possible to differentiate lane-level data from theread names themselves as I allude to in my previous post. This depends on if the read names are the original or if they were changed.

> Alternatively, y'all could potentially queryname-sort your reads to identify the blocks that correspond to dissimilar read groups, if your BAMs follow the convention that read names correspond to the RG ID or RD PU fields.

In addition to the QC-failed reads that yous say are already removed, y'all should see if reads from short inserts, where there is adaptor sequence read-through, still remain in the file. Depending on the extent of these, you lot may wish to remove them or go along knowing there is a minimal corporeality of these. You tin can employ Picard'due south MarkIlluminaAdapters for such metrics.

Singletons can still inform your analyses. Just make sure the unmapped mate is nowadays in the file as well. Otherwise, this may crusade problems with some tools, eastward.g. MarkIlluminaAdapters.


From jfiksel on 2017-06-28

I was successfully able to practise this step for Tutorial #6483. Nevertheless, when using RevertSam with the aforementioned settings, except with one of my own BAM files, I encountered the following error:

"CIGAR M operator maps off stop of reference"

Is there a processing step I accept to do to the BAM file before I use RevertSam to get a uBAM?


From shlee on 2017-06-29

Hello @jfiksel,

That doesn't audio correct. Sanitizing and reverting alignments to uBAM should non care near alignment information. We would want to keep these reads, since presumably nosotros are reverting for fresh (and hopefully meliorate) alignment results.

Would y'all mind submitting a problems report with a snippet of your data that allows us to recapitulate the error you are seeing? This will really help us. Instructions are in Commodity#1894: .


From jfiksel on 2017-06-29

Hello @shlee,

Thank you for the response. I believe that I have uploaded the necessary files to the ftp and they should be located in `jfiksel_revertsam_bug.zip`. If they're not there, it would be great if you could link to how to upload files to the ftp server, since I have never used ftp file transfer before.

Jacob


From shlee on 2017-06-thirty

Hello @jfiksel,

I can recapitulate the error with your test data. I've requested that RevertSam, when REMOVE_ALIGNMENT_INFORMATION=truthful, not become hung upwards on odd alignments due to read filters.

The cause of the fault was that the CIGAR string did non correctly represent the beyond-end-of-reference alignment. For the particular read in the error message, instead of a 100M, the CIGAR should exist 74M26S.

To get you going to where you lot need to go, you tin run CleanSam on your information before running RevertSam. CleanSam will soft-clip across-end-of-reference alignments and correct the CIGAR string.

Thanks again for the test data.


From jfiksel on 2017-06-thirty

Thanks for the quick response @shlee ! I successfully was able to consummate these steps after first running CleanSam so running AddOrReplaceReadGroups. I noticed that if I did this without adding in read groups (but after running CleanSam), I got a nothing pointer exception error. Information technology would be peachy if yous could keep me updated with the status of this event, since running CleanSam can add together a significant corporeality of processing fourth dimension for some of the larger WGS files I'chiliad working with.


From shlee on 2017-06-30

@jfiksel, y'all can track the condition of this bug fix at https://github.com/broadinstitute/picard/issues/849. You can also comment in these upshot tickets as Picard is an open-source repo. Depending on who picks upwards this work, someone here at the Broad or external, they may ask that nosotros share your test data. Would y'all be okay with that?


From jfiksel on 2017-07-03

Thanks @shlee . And yep, that is no problem.


From dannykwells on 2017-07-21

Howdy folks,

Nosotros're running into a problem with Revert Sam.

When we run:

"java -Xmx8G -jar ${PICARD_PATH}/picard.jar RevertSam I=${SAMPLE_NAME}.bam O=${TMP_DIR}/${SAMPLE_NAME}_rev.bam ATTRIBUTE_TO_CLEAR=XT ATTRIBUTE_TO_CLEAR=XN ATTRIBUTE_TO_CLEAR=As ATTRIBUTE_TO_CLEAR=OC \ ATTRIBUTE_TO_CLEAR=OP ATTRIBUTE_TO_CLEAR=X0 ATTRIBUTE_TO_CLEAR=AM ATTRIBUTE_TO_CLEAR=SM"

we are getting, one ii/22 files:

Running RevertSam
[Wed Jul 19 00:41:20 UTC 2017] picard.sam.RevertSam INPUT=R7495_N.bam OUTPUT=/TMP_R7495_N/R7495_N_rev.bam OUTPUT_BY_READGROUP=false OUTPUT_BY_READGROUP_FILE_FORMAT=dynamic SORT_ORDER=queryname RESTORE_ORIGINAL_QUALITIES=true REMOVE_DUPLICATE_INFORMATION=true REMOVE_ALIGNMENT_INFORMATION=true ATTRIBUTE_TO_CLEAR=[NM, UQ, PG, Doc, MQ, SA, MC, As] SANITIZE=faux MAX_DISCARD_FRACTION=0.01 VERBOSITY=INFO Tranquility=fake VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=five MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json
[Wed Jul xix 00:41:20 UTC 2017] Executing every bit root@135b4c4f0e37 on Linux 3.xvi.0-4-amd64 amd64; OpenJDK 64-Chip Server VM 1.eight.0_131-8u131-b11-0ubuntu1.16.04.2-b11; Picard version: ii.9.2-SNAPSHOT
…
Exception in thread "master" picard.PicardException: Two reads with same name but not correctly marked as 1st/2nd of pair: C4JL4ACXX140706:6:1101:10015:69192
at picard.illumina.MarkIlluminaAdapters.doWork(MarkIlluminaAdapters.java:224)
at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:205)
at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:94)
at picard.cmdline.PicardCommandLine.master(PicardCommandLine.java:104)

Any thoughts near what is going on, or how we tin get around it? We aren't using SANITIZE=true considering of its potentially destructive nature, only I would be fine throwing unmarried reads out (or weird pairs, like this) if nosotros could avoid this issue.

All help will be slap-up!


From shlee on 2017-07-21

Hello @dannykwells,

Any reason to suspect your BAM contains a mix of PE and SE reads? If so, try setting `OUTPUT_BY_READGROUP` to true. Or is this RNA data that have been split by Ns?

The mistake:

> Exception in thread "main" picard.PicardException: 2 reads with same name but non correctly marked every bit 1st/2nd of pair: C4JL4ACXX140706:half-dozen:1101:10015:69192
> at picard.illumina.MarkIlluminaAdapters.doWork(MarkIlluminaAdapters.java:224)

occurs when the tool encounters reads with the same name as would typically occur for mates or for secondary/supplementary alignments. The tool checks for first and second of pair flags and if the two reads lack each of these, and so it throws an exception you see.


From dannykwells on 2017-07-21

Hi,

These samples are DNA, and all were sequenced together (at the Broad, actually). 22 samples were done together, and 5 are throwing this error.

Any other thoughts on how to become effectually this?


From shlee on 2017-07-21

@dannykwells, can you postal service the records? That is, can we take a await at, e.thousand. `C4JL4ACXX140706:vi:1101:10015:69192`?


From huangkang on 2017-09-29

Hi @shlee ,

I got an fault

> Exception in thread "main" picard.PicardException: In paired fashion, read name one (SRR4340020.1.1) does non match read proper name ii (SRR4340020.i.2)
> at picard.sam.FastqToSam.getBaseName(FastqToSam.java:445)
> at picard.sam.FastqToSam.doPaired(FastqToSam.java:337)
> at picard.sam.FastqToSam.makeItSo(FastqToSam.java:308)
> at picard.sam.FastqToSam.doWork(FastqToSam.java:281)
> at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:268)
> at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:96)
> at picard.cmdline.PicardCommandLine.main(PicardCommandLine.coffee:106)

I approximate the reason is when I splited SRA format into ii separate fastq files, they look similar this:
```

SRR4340020.1.i HISEQ:470:HHMLKBCXX:ane:1101:1538:1978 length=100 CAGGCAGCAAGCAGTGGTATCAACGCAGAGTACCAGGCAGCAAGCAGTGGTATCAACGCAGAGTACCAGGCAGCAAGCAGTGGTATCAACGCAGAGTACC ``` ```

SRR4340020.1.two HISEQ :470:HHMLKBCXX:1:1101:1538:1978 length=100
GTACTCTGCGTTGATACCACTGCTTGCTGCCTGGTACTCTGCGTTGATACCACTGCTTGCTGCCTGGTACTCTGCGTTGATACCACTGCTTGCTGCCTGG

```
Didn't take the `/1` and `/two` read proper noun suffixes, and they have different head head name `@SRR4340020.ane.1` and `@SRR4340020.1.2`.

Have you ever met the same mistake? Cheers!


From Sheila on 2017-10-02

@huangkang
Hi,

Soo Hee is only getting back from vacation and getting caught upward. She volition respond asap :smiley:

-Sheila


From shlee on 2017-ten-03

Hi @huangkang,

Yes, I take seen a similar error before, from some other user. The brusk respond to your issue is that the tool expects/1 and/2demarcations, if any, at the end of paired read names.

Ane thing is that the reads y'all listing do not appear to me in the conventional FASTQ format. Here is an case pair from one of my files: ``` @H25T3CCXX150306:2:2122:7546:47369/1 AGCAATAGGAAAGTGCCTCCTGATGGTTTACAGTGTTCACCTGCTTCGGTAACTGCTAATTTTAAACCAGAACCTACAGTCCATATTCATTAAAGAAGAGCTAGCTTACCAACATCATTCAAATTCAGGAGATAAGATTGGCCAGAGAAAG +

==????==<========<===<====<<><=====<<=<=====<<seven==>=<====>==<<<>==<===<=<=>>=>>>=>>>?>==>>=?>>>=>>=>>>?>>>=?=>>>=??>??==????>>???>???@??>@?@@@?@@??<==@ @H25T3CCXX150306:2:2122:7546:47369/two GGAGAGAGACATCTATGGGCCATCATGTCATTGCTTTCCACAGCTGCAGAACAAATGTGTTTCTCCAGGTGAAAAACTATAAACCTGCTTTCTCTGGCCAATCTTATCTCCTGAATTTGAATGATGTTGGTAAGCTAGCTCTTCTTTAATG + <;<=>><=<<==<=>=====<==<===<<==<===<<<==<========<=<===========>=>>>>>>=>>>>=>?>?>>=>>5>;=:=>>??8>:??=8?=@?>.;??;>@??<0?@>=?@<>

So exist sure the format of your FASTQ is uniform with FastqToSam.

Second, I want to signal you to a section I wrote to update the read group document at https://gatkforums.broadinstitute.org/gatk/give-and-take/6472/read-groups. This department is titledDeriving ID and PU fields from read names. Observe that the example read names I give besides indicate tile number, 10-coordinate of cluster and y-coordinate of cluster. This information is important towards differentiating optical duplicates (which are omitted from estimating library complication) and mayhap for BQSR.

Given this, consider the post-obit options.

  1. Use instead yourHISEQ:470:HHMLKBCXX:1:1101:1538:1978or portions thereof equally the read name.
  2. Add in the/i and/2demarcations presumably given by theSRR4340020.1.1 andSRR4340020.i.two. It is important to distinguish which of the pair was read first and which 2nd every bit that read second tends to have lower base qualities and you want to track this information.

From Vzzarr on 2017-ten-11

I am executing FastqToSam, only it seems that its execution is single threaded: is it possible to ameliorate efficiency, with parameters similar to-nt or-nct ?


From Sheila on 2017-10-12

@Vzzarr
Hi,

I don't retrieve in that location is an easy manner to multi-thread FastqToSam. Some Picard tools accept an pick NUM_PROCESSORS or THREAD_COUNT, but that tool does not.

-Sheila


From Vzzarr on 2017-ten-14

@Sheila
I constitute a mode to parallelize FastqToSam with Spark, but only with more input samples.

Give thanks you very much for your answer,
Nicholas


From mzabidi on 2017-ten-xvi

samtools view input.bam | cutf 12 | tr '\t' '\n' | cut -d ':' -f 1 | awk '{ if(!x[$1]++) { print }}'

could be simplified to

samtools view input.bam | cutf 12 | tr '\t' '\north' | cut -d ':' -f 1 | awk '!x[$1]++'


From Sheila on 2017-10-18

@mzabidi
Hi,

Thanks for the tip :smiley:

-Sheila


From bwray on 2017-10-26

Howdy vivid GATK team, I've encounter an issue with converting some aligned bam files to unaligned, and I thought that maybe you could help me.

I've got some bam files that were aligned to a custom reference which includes hg19 in addition to sequences from cancer-related viruses as well as [ERCC spike-ins](http://tools.thermofisher.com/downloads/ERCC92.fa "ERCC spike-ins") and some other stuff. I don't have access to the raw reads, though I do have admission to the reference that the reads were aligned to when making the bam files.

My bam files are from paired samples (i each control and tumor) and I'1000 ultimately interested in looking for somatic mutations via something like mutect2.

OK, so I searched my bam files for which alignment tags to target and composed the following command using picard.jar downloaded on 25-sep-2017:

java -Xmx8G -jar /path/to/picard.jar RevertSam I=firstSample.bam \ O=firstSample_revertsam.bam \ SANITIZE =true \ MAX _DISCARD_FRACTION=0.005 \ ATTRIBUTE _TO_CLEAR=OC \ ATTRIBUTE _TO_CLEAR=OP \ ATTRIBUTE _TO_CLEAR=RG \ ATTRIBUTE _TO_CLEAR=XS \ SORT _ORDER=queryname \ RESTORE _ORIGINAL_QUALITIES=true \ REMOVE _DUPLICATE_INFORMATION=true \ REMOVE _ALIGNMENT_INFORMATION=true \ TMP _DIR=/path/to/tempDir

The procedure moves forth well plenty until it gets into the sequences that are aligning to the viral elements of the reference, at which point the output can no longer give a read position. Here is the error message in context (at this point it had already reverted the sequences aligned to autosomal chromosomes of GRCh37):

> read position: 10:154,005,195 > INFO 2017-x-26 13:59:xxx RevertSam Reverted 283,000,000 records. Elapsed time: 00:44:40s. Time for last 1,000,000: 9s. Last > read position: GL000236.1:13,855 > INFO 2017-10-26 13:59:39 RevertSam Reverted 284,000,000 records. Elapsed time: 00:44:49s. Time for last 1,000,000: 8s. Concluding > read position: hs37d5:1,465,475 > INFO 2017-10-26 13:59:49 RevertSam Reverted 285,000,000 records. Elapsed time: 00:44:58s. Time for final one,000,000: 9s. Terminal > read position: hs37d5:20,357,882 > INFO 2017-10-26 13:59:58 RevertSam Reverted 286,000,000 records. Elapsed time: 00:45:08s. Time for terminal 1,000,000: 9s. Last > read position: /  > INFO 2017-10-26 14:00:04 RevertSam Reverted 287,000,000 records. Elapsed time: 00:45:13s. Fourth dimension for terminal 1,000,000: 5s. Concluding > read position: /  > INFO 2017-10-26 14:00:07 RevertSam Reverted 288,000,000 records. Elapsed time: 00:45:17s. Time for last 1,000,000: 3s. Last > read position: /  > INFO 2017-10-26 14:00:11 RevertSam Reverted 289,000,000 records. Elapsed time: 00:45:20s. Fourth dimension for last ane,000,000: 3s. Final > read position: /  > INFO 2017-x-26 fourteen:00:12 RevertSam Detected quality format for HCGCJBBXX_1_J02043: Standard > INFO 2017-10-26 14:00:12 RevertSam Detected quality format for HCGCJBBXX_2_J02043: Standard > INFO 2017-10-26 14:00:12 RevertSam Detected quality format for HCGCJBBXX_3_J02043: Standard > INFO 2017-10-26 14:00:12 RevertSam Detected quality format for HCGCJBBXX_4_J02043: Standard > [Thu Oct 26 14:01:09 CDT 2017] picard.sam.RevertSam done. Elapsed time: 46.33 minutes. > Runtime.totalMemory()=3386376192 > To get aid, run into http://broadinstitute.github.io/picard/index.html#GettingHelp > Exception in thread "master" java.lang.NullPointerException > at picard.sam.RevertSam.sanitize(RevertSam.coffee:400) > at picard.sam.RevertSam.doWork(RevertSam.java:274) > at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:205) > at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:94) > at picard.cmdline.PicardCommandLine.chief(PicardCommandLine.java:104)

I'd appreciate any direction you could requite me, and thanks!
B


From bwray on 2017-ten-27

Sorry, I noticed a small typo in the log running up to the error. Where the read position is just a slash, it should instead exist a slash bracketed by asterisks', i.e./


From Sheila on 2017-10-29

@bwray
Hi B,

What happens when you try validating your input BAM file with [ValidateSamFile](http://broadinstitute.github.io/picard/control-line-overview.html#ValidateSamFile)?

Thanks,
Sheila


From bwray on 2017-10-xxx

Good morning [Sheila](https://gatkforums.broadinstitute.org/firecloud/profile/Sheila "Sheila"),

Thanks for responding.

I've run ValidateSamFile on the first six samples so far, and all of the outputs report No errors constitute.

However, the "Terminal read position" for each sample is inconsistent.

Sample ane
Last read position: \*/\*
Sample 2
Last read position: Ten:111,833,845
Sample 3
Concluding read position: \*/\*
Sample iv
Last read position: 10:148,817,477
Sample 5
Terminal read position: \*/\*
Sample 6
Last read position: GL000220.1:146,293

Here's the template for the command I ran:
coffee -jar /path/to/picard.jar ValidateSamFile I=input.bam MODE=SUMMARY O=summary_input.bam

Thanks,
B


From Sheila on 2017-11-01

@bwray
Hi B,

Interesting. Can you ostend you lot are using the latest version of Picard? I need to check with the squad on what may be happening hither. We will get back to you lot soon.

-Sheila


From shlee on 2017-11-01

Hi @bwray,

Based on what you say:
> The procedure moves along well enough until it gets into the sequences that are aligning to the viral elements of the reference, at which point the output can no longer give a read position.

I see two options for you to movement forward.

1. If you do not intendance about reads that align to the viral elements and afterwards contigs in the reference, and so y'all tin can subset your alignments to those contigs you care about using PrintReads + `-L` and revert just these.
2. If you do care about all the reads, and so see if setting RevertSam's `VALIDATION_STRINGENCY` to LENIENT or SILENT lets the procedure consummate. Picard v2.10.6+ updated RevertSam to interpret the LENIENT/SILENT settings to ignore whatever alignment information that causes ValidateSam to fault, which in plow in prior versions caused RevertSam to fail besides.

Solution 2 would simply work if the validation step is causing your RevertSam pace to error. Otherwise, can you post a few of the read records that align to contigs that error the reversion? Thank you.


From namratha on 2017-12-19

hello,
I followed the procedure to generate a UBAM file from a FASTQ file but my new UBAM file is created with a size of 0, i am not sure why, I followed the code exactly merely irresolute the the fastq files and the run date


From shlee on 2017-12-xx

Hi @namratha,

We'll need more information from yous to help diagnose what may exist going on. For starters, please follow pedagogy #6 below:

1. Search using the upper-right search box, e.k. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
iv. Tell united states whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (capture kit) or WGS (PCR-costless or PCR), paired- or single-end, read length, expected average coverage, somatic data, etc.
half-dozen. For tool errors, include the error stacktrace too as the exact command.
7. For format issues, include the result of running [ValidateSamFile](https://software.broadinstitute.org/gatk/guide/article?id=7571) for BAMs or ValidateVariants for VCFs.
viii. For weird results, include an illustrative example, e.grand. attach IGV screenshots co-ordinate to Article#5484.
9. For a seeming variant that is uncalled, include results of post-obit Article#1235.


From Kemool on 2018-04-08

Hello, I apologize in advance for the lack of cognition/experience in this, I am but starting and am trying to figure things out. Afterward generating a BAM file using the FastqToSam I do non get any fault messages in last just do not know how to view the new BAM file. I tried opening it in IGV merely it gives me the fault "Error loading /Users/kellymoolick/Downloads/picard-2.18.two/tutorial_6484_FastqToSam/6484_snippet_fastqtosam.bam: An error occurred while accessing: /Users/kellymoolick/Downloads/picard-2.xviii.two/tutorial_6484_FastqToSam/6484_snippet_fastqtosam.bam Error loading BAM file: org.broad.igv.exceptions.DataLoadException: An error occurred while accessing: /Users/kellymoolick/Downloads/picard-2.18.2/tutorial_6484_FastqToSam/6484_snippet_fastqtosam.bam.bai Index file not plant. Tried /Users/kellymoolick/Downloads/picard-2.18.2/tutorial_6484_FastqToSam/6484_snippet_fastqtosam.bai"

Thank you!!


From Sheila on 2018-04-09

@Kemool
Hi,

It looks like y'all don't have alphabetize files for the BAM files. You can index them using samtools index. Have a await at [this article](https://gatkforums.broadinstitute.org/gatk/word/2909) for more help.

-Sheila


From FPBarthel on 2018-05-01

Hi, thanks for providing this slap-up tool to the community. Practice you have any information well-nigh the impact of RevertSam (esp. reversal of base recalibration scores) on downstream variant calling? 1 reason I enquire is that I noticed that the GDC pipeline (https://docs.gdc.cancer.gov/Data/Bioinformatics_Pipelines/DNA_Seq_Variant_Calling_Pipeline/) does seem to utilize this footstep.

P.s. is at that place whatsoever good reference that explains all the BAM/FASTQ attributes, eg. XT, CO, AS, etc? I have tried a lot of googling merely accept not found a satisfactory resource.


From shlee on 2018-05-01

Hi @FPBarthel,

When y'all perform RevertSam, nosotros recommend yous `RESTORE_ORIGINAL_QUALITIES` and go through BQSR afresh with the new alignment data. Nosotros exercise non recommend performing BQSR on data that has already undergone recalibration. If your information to be reverted did non save the original qualities, and if y'all are curious, then you canmeet how well the base qualities match expectations by undergoing BQSR with the new alignments. Again, do non utilize twice-recalibrated reads. Every bit far as I know, we accept non looked into the impact of twice-recalibrated alignments.

The GDC pipeline performs BQSRsubsequently indel realignment.

![](https://the states.v-cdn.cyberspace/5019796/uploads/editor/wd/30v8bh80w8hs.png "")

Check out the SAM specification (SAM v1) at https://samtools.github.io/hts-specs/. The tags are described in a supplementary document (SAM tags). The links to the specs are on the left side.


From FPBarthel on 2018-05-01

Cheers @shlee ! That clears information technology up.

I had plant the SAM specifications already, just information technology does not list the tags that I was looking to get information on (FT, XN and XT). I tried searching google for a reference of these "end-user specific tags" (specific to GATK and related tools) but without much result, except that FT is related to BQSR?


From Samir on 2018-05-01

XT is bwa specific tag1,2

```
XT tag, e.g. XT:A:U = unique mapper; XT:A:R = more than 1 loftier-scoring matches
```

FN is probably number of read features in each record3.

[i]: https://genome.sph.umich.edu/wiki/SAM
[2]: http://physiology.med.cornell.edu/kinesthesia/elemento/lab/R/CSHL_2012/CSHL-basic-HTS-2012.pptx
[3]: https://samtools.github.io/hts-specs/CRAMv3.pdf


From Sheila on 2018-05-08

@FPBarthel
Hi,

FT tells y'all the reason why the record has been unaligned or marked every bit not-passing filters.

XN tells you the number of ambiguous bases in the reference.

XT tells you whether the read is uniquely mapped or not.

-Sheila


From jejacobs23 on 2018-06-19

There was a previous tutorial ,(howto) Revert a BAM file to FastQ format (https://gatkforums.broadinstitute.org/gatk/discussion/2908/howto-revert-a-bam-file-to-fastq-format), that indicated that an important component was the shuffle pace. If the goal is to take a .bam file and revert information technology back to a uBAM and ultimately a FASTQ file and so that the user can and so clarify the reads in their own pipeline, and then is this current tutorial the advisable tool to apply? Is there a shuffle-like procedure build into the RevertSam function?


From shlee on 2018-06-19

How-do-you-do @jejacobs23,

To quote a passage from the higher up tutorial:

![](https://u.s.a..v-cdn.net/5019796/uploads/editor/y8/11h7iwnet8ov.png "")


From Ojo on 2019-08-28

Hello,

I tried converting paired WGS fastq files (SRR7665095_1.fastq.gz and SRR7665095_2.fastq.gz from m Genomes) to uBAM format but ran into a problem.

Showtime read of SRR7665095_1.fastq.gz:
```@SRR7665095.1 one/one```
```ATCCCTCCCCACTTCCCCCACCCCACAACAGTCCCTGGGGGGTTATTTTCTTAGGTTTGATTTCTGTTTTTATTGCCTCATGGTCCAAAAGTGTGGTAGGTATGATTTCACCTTTTTTTGAATTTTCTTAGTGTTGTGTTATTGCTGTTG```
```+```
```AAAF7FFJJJ-AFJJJJJJJJJJJAAJFFJAF-AAJFFJJJ-AAFJJJJJA7-AAJA—7F——```

starting time read of SRR7665095_2.fastq.gz:
```@SRR7665095.ane 1/2```
```TGCAAATAGACGTAAATAATTACACAATAATAGTGGGAGACTTTAACAGCCCACTGACCATGTTAGATAGATCACTGAGACATAAAACTAATTAAGCATTTAAGACCTGAACTTGACACTTTACCAAATCGAACTAACAGACATCTACAA```
```+```
```AAAFFJFFJJJFFJJJAJJ-AJAJJJJJJJJFAJJJJ

I used the following command line used which generated an error message:
```java -Xmx8G -jar ~/bin/picard.jar FastqToSam FASTQ=SRR7665095_1.fastq.gz FASTQ2=SRR7665095_2.fastq.gz OUTPUT=SRR7665095_fastqtosam.bam SAMPLE_NAME=SRR7665095 PLATFORM=illumina RUN_DATE=2019-08-28T11:02:04+01:00```

Error message:
```Exception in thread "main" htsjdk.samtools.SAMException: invalid code lengths fix at line 8065173 in fastq SRR7665095_1.fastq.gz at htsjdk.samtools.fastq.FastqReader.readNextRecord(FastqReader.java:139) at htsjdk.samtools.fastq.FastqReader.next(FastqReader.java:152) at picard.sam.FastqToSam.doPaired(FastqToSam.java:404) at picard.sam.FastqToSam.makeItSo(FastqToSam.java:380) at picard.sam.FastqToSam.doWork(FastqToSam.java:353) at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:305) at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:103) at picard.cmdline.PicardCommandLine.main(PicardCommandLine.coffee:113)
Caused by: java.util.cipher.ZipException: invalid code lengths prepare at java.util.zip.InflaterInputStream.read(java.base@9-internal/InflaterInputStream.java:164) at coffee.util.null.GZIPInputStream.read(java.base@nine-internal/GZIPInputStream.java:117) at sunday.nio.cs.StreamDecoder.readBytes(java.base of operations@nine-internal/StreamDecoder.coffee:284) at sun.nio.cs.StreamDecoder.implRead(java.base@9-internal/StreamDecoder.java:326) at sun.nio.cs.StreamDecoder.read(java.base@ix-internal/StreamDecoder.java:178) at java.io.InputStreamReader.read(java.base@9-internal/InputStreamReader.java:185) at java.io.BufferedReader.fill(coffee.base@ix-internal/BufferedReader.coffee:161) at java.io.BufferedReader.readLine(java.base of operations@nine-internal/BufferedReader.java:325) at java.io.BufferedReader.readLine(coffee.base@ix-internal/BufferedReader.java:390) at htsjdk.samtools.fastq.FastqReader.readLineConditionallySkippingBlanks(FastqReader.java:207) at htsjdk.samtools.fastq.FastqReader.readNextRecord(FastqReader.java:114) … vii more```

Java version: openjdk version "9-internal"
Picard Version: two.20.half dozen-SNAPSHOT

Here's the read in SRR7665095_1.fastq.gz file starting at the troublesome line 8065173 (@SRR7665095.2016294 2016294/ane):

```@SRR7665095.2016294 2016294/ane```
```TGAGTCCCCAAGATTTATTTTCCCTTCGTAAGTGTTCCTATGAGTATTAATTATTCATTGTGTCTTTTATTACACAAATAAGGCACAGATTTTTAAGAAATCATCAACTTCATGGCTACCTATATAGACATAATTACACAGAAGCTCAAC```
```+```
```AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

I'thousand non sure what is wrong with line 8065173 in the file. Tin can someone help delight?


From Terrymoore11 on 2019-10-23

Buy IELTS document online, Buy TOEFL certificate online, Buy GRE Certificate Online, Buy GMAT Certificate Online, Buy CAE Certificate Online, Buy NEBOSH Certificate Online, Buy PTE Certificate Online,
Buy CAE certificate online, Registered IELTS certificate for auction, IELTS document without exam, Buy original IELTS certificate, Buy CAE document online, Buy TOEFL certificate online, Buy IELTS certificate online, Buy GRE Certificate Online, Buy GMAT Certificate Online, Purchase original IELTS certificate, IELTS certificate without exam, Buy IELTS Certificate In Romania – Purchase IELTS Certificate in Spain – Buy Verified IELTS certificate in Belarus – Buy IELTS Without Examination in Bulgaria – Buy Existent IELTS Certificate in Czechia – Buy IELTS Certificate In Hungary – Buy Original IELTS document in Poland – Purchase IELTS Certificate In Moldova – Purchase IELTS Document in Russia – Buy IELTS Certificate in Slovakia – Buy IELTS Certificate In Ukraine – Buy IELTS Certificate In Aland Islands – Purchase IELTS Certificate In Denmark – Buy IELTS Certificate In Estonia – Buy IELTS document in Faroe Islands – Purchase ielts without exam in Finland – Buy IELTS Without Examination in Guernsey – Buy Registered IELTS certificate in Iceland – Purchase Certified IELTS document in Ireland – Buy IELTS Certificate in Isle of Homo – Buy IELTS Document in Jersey – buy ielts certificate without exam in Latvia – Purchase IELTS Certificate Without Examination In Republic of lithuania – Buy IELTS Certificate In Norway – Buy IELTS Certificate In Sark – Buy Registered IELTS Certificate in Sweden – Buy IELTS Document In United kingdom of great britain and northern ireland – Buy IELTS Without Exam in Albania – Buy IELTS certificate In Principality of andorra – Buy IELTS Certificate in Bosnia and herzegovina – Buy IELTS document in Croatia – Buy IELTS certificate in Gibraltar

Looking IELTS/TOEFL/GMAT/GRE/PTE/CAE without Exams? Contact united states to BUY ORIGINAL IELTS/TOEFL CERTIFICATES, Get resident permit in Canada, Australia, Europe, Buy registered IELTS/TOEFL Certificate WhatsApp: +1 (925) 391-8330 Websitelink:immigrationcertificate.wordpress.com

Buy Genuine Registered IELTS Document Without Attending Examination
YOUR PATHWAY TO IELTS SUCCESS
? Purchase Original and Authentic IELTS, TOEFL, GMAT, GRE, PTE, CAE, SAT, PMP, CELPIP, TESOL, NEBOSH, FCE, PSAT, Certificates
? Purchase IELTS Certificates With Your Desired Score Band without Test
? 100% registered and verifiable IELTS certificates online
WhatApp:9253918330
Purchase IELTS certificate online, Buy TOEFL certificate online, Buy GRE Certificate Online, Buy GMAT Certificate Online,
Buy CAE document online, IELTS Document for sale, Registered IELTS certificate for sale, IELTS certificate without test, Buy original IELTS certificate, Buy CAE certificate online, Buy TOEFL certificate online, Buy IELTS certificate online, IELTS Certificate for sale, Registered IELTS document for auction, Buy GRE Document Online, Purchase GMAT Document Online, Buy original IELTS certificate, IELTS certificate without exam, Purchase IELTS Certificate In Romania – Buy IELTS Certificate in Spain – Purchase Verified IELTS document in Belarus – Buy IELTS Without Examination in Republic of bulgaria – Purchase Real IELTS Document in Czech Democracy – Buy IELTS Certificate In Hungary – Buy Original IELTS certificate in Poland – Buy IELTS Certificate In Moldova – Purchase IELTS Certificate in Russia – Buy IELTS Certificate in Slovakia – Buy IELTS Certificate In Ukraine – Buy IELTS Document In Aland Islands – Purchase IELTS Document In Kingdom of denmark – Buy IELTS Certificate In Republic of estonia – Purchase IELTS document in Faroe Islands – Buy ielts without test in Finland – Buy IELTS Without Exam in Guernsey – Buy Registered IELTS document in Iceland – Buy Certified IELTS certificate in Ireland – Purchase IELTS Certificate in Island of Man – Buy IELTS Certificate in Jersey – buy ielts certificate without exam in Republic of latvia – Purchase IELTS Certificate Without Exam In Lithuania – Buy IELTS Certificate In Norway – Purchase IELTS Certificate In Sark – Buy Registered IELTS Certificate in Sweden – Buy IELTS Certificate In United Kingdom – Purchase IELTS Without Examination in Albania – Buy IELTS certificate In Andorra – Buy IELTS Certificate in Republic of bosnia and herzegovina – Buy IELTS certificate in Croatia – Buy IELTS certificate in Gibraltar

Looking IELTS/TOEFL without Exams? Contact us to Purchase ORIGINAL IELTS/TOEFL CERTIFICATES, Get resident permit in Canada, Commonwealth of australia, Europe, Buy registered IELTS/TOEFL Certificate WhatsApp:+one (925) 391-8330

Buy Genuine Registered IELTS Document Without Attending Test
YOUR PATHWAY TO IELTS SUCCESS
? Purchase Original and Accurate IELTS, TOEFL, GMAT, GRE, PTE, CAE, Sabbatum, PMP, CELPIP, TESOL, NEBOSH, FCE, PSAT, Certificates
? Buy IELTS Certificates With Your Desired Score Band without Exam
? 100% registered and verifiable IELTS certificates online
WhatApp:+one (925) 391-8330

''Buying Bitcion online in India. Any amount as from $200 dollars
Contact united states of america via WhatsApp:+one (925) 391-8330 for a prper and serious discussion''

Buy IELTS Certificate online | Genuine IELTS Certificate without Test

We are grouping of teachers and Examiner's, specialized in the acquisition of Registered/valid/legit/Authentic IELTS, TOEFL, GMAT, GRE, PTE, CAE, SAT, PMP, CELPIP, TESOL, NEBOSH, FCE, PSAT,Nebosh Etc English language Speaking document.. We work with the British Quango; IDP: IELTS Australia and University of Cambridge ESOL Examinations (Cambridge ESOL). database technicians who are responsible for Exam report verification and registration of all IELTS results and with our help, y'all have guaranteed entry of your information into the corresponding database (IDP/BC) with valid test results to proof without whatever problem. The IELTS/Toefl Certificates nosotros event are legit and verifiable and valid for two years. Our IELTS/Toefl/pte Certificates serve migration processing and also in obtaining Permanent Residence…
WhatApp:+1 (925) 391-8330
Websitelink:immigrationcertificate.wordpress.com

- We simply produce Real and IDP/BC verified IELTS Certificates

- We do not produce fake IELTS certificates as they serve no purpose

- We keep client data discreet and nosotros practise not share with any tertiary party
With these Certificates you have a shot at a migration process.

*Please note that All real IELTS, TOEFL, GMAT, GRE, PTE, CAE, SAT, PMP, CELPIP, TESOL, NEBOSH, FCE, PSAT, Certificates should be Original and registered in the database.

WhatApp: +1 (925) 391-8330
or
Email: (immigration.certificate01@yahoo.com) Websitelink:immigrationcertificate.wordpress.com

Two IELTS tests: Academic and General

Why yous're doing the IELTS examination volition effect which kind of exam y'all cull:

The Academic module is normally for people who want to written report an undergraduate or postgraduate degree course or who wish to annals with a professional body.
The Full general Preparation module focuses on basic survival skills in a broader social and educational setting. General Training is suitable if you are joining a preparation programme or doing work experience in English language speaking countries. It is not designed for degree level.
Please annotation, if y'all are applying to an organisation you must cheque with them to brand sure you choose the correct IELTS test.

Our Services:

1- we provide Official certificate with registration into the database and bodily center stamps for customers interested in obtaining the certificate without taking the test.

2- If you lot already took the test and it is less than a month that you took the exam, we can update the results obtained in your previous examination to provide you with a new certificate with the updated results for you to follow you PR procedures without any risk.

iii- we can provide Question papers for future examination before the actual examination date. the questionnaires will be issued about 6 to 10 days earlier the test data and will exist 100% aforementioned questions that will appear in the test. guaranteed at 100%.

iv- We are teachers and examination officials working together every bit team so you can selection any of our proffessional to go in for the exams on your behafl.

5- Yous tin annals for your exams and go in for simply we shall provide your target scores as you request because we have hole-and-corner partners working at any heart test which give united states access into the system.

ABOUT U.s.:

>>We are fast, reliable and flexible

>>Nosotros are pop and trusted

>>Nosotros are highly experienced

>>We have excellent pass into database.

WhatApp: +one (925) 391-8330
or
Email: (immigration.certificate01@yahoo.com)

*Practice yous need Real and IDP/BC verified IELTS Certificates? *Do you like to Get bookish or general IELTS Certificate Examination? *Are Yous trying to go Band 7,8,9 or more in IELTS certification in Asia, Europe, America, Africa etc ? *Practice you lot need to edit and increase your past score ? *Exercise you lot need a teacher to write the exams for yous ? *Do yous need questions/examination/exams newspaper both questions and answers ? *Exercise you need our aid in the test to provide your target score even if you lot fail ?
We tin help you!!!

Some may non have the time or patience to do this and some may be afraid of complications not to have the right agent from the correct source. At that place are many agents and their competence (and honesty!) ranges from excellent all the mode down to not-existent.

1 may decide to employ an agent to help and advice on how to get his/her certificate. But, if you do decide to utilize an agent, be conscientious especially on the net. Nosotros ALWAYS Advise OUR CLIENTS TO BE Conscientious .

The best way to ensure that you are in directly deal with competent, professional and honest officials, feel free to leave us a message, using email: (immigration.certificate01@yahoo.com)

Our representatives are waiting to reply to your inquiries 24/7, and ready you on your way toward obtaining your IELTS, TOEFL, GMAT, GRE, PTE, CAE, Sat, PMP, CELPIP, TESOL, NEBOSH, FCE, PSAT, certificates that may dramatically change your life for the better!.

Through us it is straight forward; with a little time and attempt to spent

WhatApp: +ane (925) 391-8330
or
Electronic mail: (clearing.certificate01@yahoo.com)

Websitelink:immigrationcertificate.wordpress.com
=======KEYWORDS=========
obtain your desired scores in IELTS
get real ielts without exams in karachi,
get real ielts without exams in Cathay
buy ielts certificate in saudi arabia,
buy ielts certificate in Prc
go existent ielts without exams in state of kuwait,
purchase ielts certificate in islamic republic of pakistan,
where to buy ielts document in Korea,
get real ielts without exams in in China
how to purchase registered ielts in lebanon,
how to buy registered ielts in multan,
buy registered ielts in Prc
ielts band seven for immigration in Australia,
how to purchase registered ielts in in China
buy ilets certificate online
ielts backstairs in punjab
ielts certificate without exam in delhi
purchase ielts certificate in punjab
ielts proxy agents
ielts certificate without examination in mumbai
ielts test backstairs in hyderabad
ielts certificate without examination in punjab
purchase ielts certificate india
how to go ielts certificate without test in india
how to get ielts document without test in chennai
ielts backdoor in punjab
ielts certificate without test in kerala
buy original ielts certificate
ielts document without exam in hyderabad
ielts certificate without exam in chennai
ielts certificate without exam in kerala
ielts certificate without exam in delhi
ielts certificate without examination in punjab
ielts certificate without exam in mumbai
ielts document without test in bangalore
ielts backdoor chennai
ielts certificate without exam in chennai
buy ielts certificate india
can buy ielts document in Cathay
Obtain/Order Real IELTS certificates without Exams
Buy/larn/Obtain Genuine IELTS certificates Egypt
Obtain/Purchase IELTS certificates without Exam
buy real ielts certificates Islamabad
buy real ielts certificates in china
get ielts certificate without test in india
buy real ielts certificates in islamic republic of pakistan
buy ielts certificate Islamabad
purchase ielts certificate in Hawally, State of kuwait
get ielts document in united kingdom
get real ielts certificate in Hawally, Kuwait
buy ielts certificate in multan
get ielts document without test in pakistan
buy original ielts certificate in Great britain
purchase original ielts certificate in united kingdom
ielts certificate without exam in hyderabad
ielts certificate without exam in delhi
buy original ielts certificate in karachi
ielts certificate without test in punjab
ielts certificate without exam in china
ielts document without exam in brazil
get ielts certificate without exan in Hawally, Kuwait
how to get ielts certificate without test in brazil
Purchase original ielts in brazil
get gegistered ielts in brazil without exam
Acquired valid ielts in brazil
get ielts without exam in brazil
Employ for accurate ielts in brazil
become your desired seven in brazil
Obtain real ielts in brazil
purchase registered ielts without exam in brazil
gain existent certified ielts in brazil
ielts band seven.5 in Hawally, Kuwait
purchase ielts in brazil
ielts backdoor in Hawally, Kuwait
nosotros selling registered ielts certificate in brazil
can buy ielts certificate in brazil
ielts backdoor in Brazil
get ielts certificate in Brazil
buy original/real/registered ielts in brazil
get your desired band 7 in brazil
buy original ielts certificate in Communist china
buy ielts certificate in china
Take an IELTS test in England
Obtain Ielts Band vii in China
Obtain Ielts Ring 7 in spain
get ielts certificate in espana
buy ielts certificate in spain
apply for ielts in spain
larn registered ielts certificate in spain
go ielts online without exam
become ielts certificate without exam
ielts backdoor in kingdom of spain
buy/go/obtain ielts asap
get ielts certificate online without test
Apply for a registered ielts online
ielts certificates registration online
new ielts document proxy
Request/register/apply for real ielts document
Can I take another re-create of my IELTS Examination Report Form
get real Ielts Document Without exam in brazil
get real Ielts Document Without test in iran
how to pay for ielts exam in uk
how ro pay for ielts exam in Hawally, Kuwait
get real Ielts Certificate Without examination
buy ielts certificte without test
get real Ielts Document Without test in dubai
go real Ielts Certificate Without test in suadi arabia
buy ielts certificates in Autralia
cambridge ielts book 12 academic gratis download
become real Ielts Certificate Without test in united kingdom
get real Ielts Certificate Without test in malaysia
get real Ielts Certificate Without exam in canada
become real Ielts Certificate Without test in usa
get real Ielts Document Without test in pakistan
get real Ielts Certificate Without test in oman
get real Ielts Certificate Without test online
get real Ielts Document Without exam in multan
buy ielts certificates in multan
purchase ielts certificates in Britain
buy ielts certificate in punjab
buy original ielts certificate
get ielts certificate without exam in pakistan
buy ielts document uk
ielts score without exam
buy ielts certificate britain
ielts certificate for auction in india
purchase valid ielts certificate
ielts certificates in in communist china
ielts my status page
purchase ielts certificates in republic of india
buy ielts certificates in united kingdom
ielts certificates in united kingdom
purchase ielts certificates in islamic republic of pakistan
buy ielts certificates in karachi
buy ielts certificates in Islamabad
buy ielts certificates in Bahawalpur
IELTS Registration How practise I register
buy ielts certificates in china
how tin can i get a registered ielts certificate
Buy Ielts Document Without Exam in uae
How do I annals ielts
get ielts without exam due north islamic republic of pakistan
how tin can i get ielts certificate without test
Buy Ielts Document Without Exam in dubai
Buy Ielts Certificate Without Exam in state of kuwait
Buy Ielts Document Without Exam in india
Buy Ielts Document Without Examination in saudi arabia
Purchase Ielts Certificate Without Exam uae
go real Ielts Certificate Without test online
how do i obtain a registered ielts
ielts results 2018 how do i check ?
buy ielts certificates in united kingdom of great britain and northern ireland
Obtain/Get IELTS certificates in Bahawalpur
Obtain/Order Real IELTS certificates without Exams
how tin i meet my ielts result online
Go IELTS certificate Band 7 Bahawalpur
Get IELTS certificate Ring 7 in China
ielts band 7 for clearing in canada
Obtain/Order Real IELTS certificates without Exams IN United kingdom of great britain and northern ireland
register IELTS certificate online
Get high ring score in ielts – 100% verified and trusted?

Nosotros tin can help you to go IELTS Certificate without attending the exams ,our certificates are British Council certified.
You can use our certificates for University access and any clearing issues. The regions we cover are UAE, Qatar, Oman, Saudi arabia, Kuwait , Jordan , Australia ,Asia, Canada , Europe , Africa and US . Considering the business organization is confidential , very lilliputian information is provided to the public and details of our certificates are only provided to paying clients. Our organisation is well connected with various invigilators,British council information base managers and test centers which enables united states to annals your scores in any ielts center around the earth . All our certificates are original and British Council certified. Nosotros practise non make fake certificates!!!!

  1. If you want to travel, study or work abroad, get our,TOEIC,TIEP NEBOSH, IELTS, TOEFL, ESOL, GMAT,
    CERTIFICATES Without Attending Exam# Nosotros can also help you to get valid PASSPORT, VISA, DRIVERS LICENSE, RESIDENT PERMIT, ID Carte AND
    Nativity CERTIFICATES.

WhatApp: +1 (925) 391-833
or
Email: (clearing.certificate01@yahoo.com)

Websitelink:immigrationcertificate.wordpress.com

harperderne1951.blogspot.com

Source: https://www.sites.google.com/a/broadinstitute.org/legacy-gatk-forum-discussions/tutorials/6484-how-to-generate-an-unmapped-bam-from-fastq-or-aligned-bam

0 Response to "Gatk the Input .bam File Contains Reads With No Platform Information"

Post a Comment

Subscribe to: Post Comments (Atom)

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel